90
|
SignaGen
plenti-cmv-dest vectors encoding flag-wdr26 Plenti Cmv Dest Vectors Encoding Flag Wdr26, supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plenti-cmv+vector/plenti+cmv+dest+vectors+encoding+flag+wdr26/10__1074_slash_jbc__m111__301382-71-18-36 Average 90 stars, based on 1 article reviews
plenti-cmv-dest vectors encoding flag-wdr26 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Broad Institute Inc
shrna clone containing nlrc3 targeting sequence gcaacctctttccggaagttt Shrna Clone Containing Nlrc3 Targeting Sequence Gcaacctctttccggaagttt, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plenti-cmv+vector/plenti+cmv+blast+nlrc3++ovnlrc3++vectors/pmc06469509-475-1-11 Average 90 stars, based on 1 article reviews
shrna clone containing nlrc3 targeting sequence gcaacctctttccggaagttt - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
plenti-cmv-neo vector Plenti Cmv Neo Vector, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plenti-cmv+vector/plenti+cmv+neo+vector/pmc08156851-93-6-11 Average 90 stars, based on 1 article reviews
plenti-cmv-neo vector - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
VectorBuilder GmbH
plenticmv vector, catalog no. vpk-406 Plenticmv Vector, Catalog No. Vpk 406, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plenti-cmv+vector/plenticmv+vector++catalog+no++vpk+406/pm39641870-44-18-25 Average 90 stars, based on 1 article reviews
plenticmv vector, catalog no. vpk-406 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |